Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3462700
End position: 3462744
Length: 45

DNA sequence
>NC_010001, from 3462700 to 3462744 (45 bp); Clostridium phytofermentans ISDg GGTGGTACTGGCTTTGGTGGTGCTGGCTTTGGTGGTGCTGGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3461725-3463476	Sequence	Cphy_2836 - peptidoglycan-binding LysM (Protein is coded in complementary strand; from 3463476 to 3461725)