Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2554995
End position: 2555039
Length: 45

DNA sequence
>NC_010001, from 2554995 to 2555039 (45 bp); Clostridium phytofermentans ISDg GAGAGTGTATTAGAGGGGAGTGTATTAGAGGGGAGTGTATTAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2553345-2555243	Sequence	Cphy_2068 - peptidase M56 BlaR1 (Protein is coded in complementary strand; from 2555243 to 2553345)