Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2029305
End position: 2029349
Length: 45

DNA sequence
>NC_010001, from 2029305 to 2029349 (45 bp); Clostridium phytofermentans ISDg ACAGCCACCGAAGCAGCCGCCACCAAAGCAACCGCCACCGAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2029101-2029397	Sequence	Cphy_1646 - hypothetical protein (Protein is coded in complementary strand; from 2029397 to 2029101)