Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3945652
End position: 3945693
Length: 42

DNA sequence
>NC_010001, from 3945652 to 3945693 (42 bp); Clostridium phytofermentans ISDg CTCTTTATGTCTATCTCTTTAAGTATATTTCTTTATGCCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3945691-3947259	Sequence	Cphy_3240 - extracellular solute-binding protein (Protein is coded in complementary strand; from 3947259 to 3945691)