Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4439980
End position: 4440015
Length: 36

DNA sequence
>NC_010001, from 4439980 to 4440015 (36 bp); Clostridium phytofermentans ISDg ATTTTTCGCTTCATTTTTTGCTTCATTTTTTGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4439138-4440307	Sequence	Cphy_3593 - hypothetical protein (Protein is coded in complementary strand; from 4440307 to 4439138)