Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4328252
End position: 4328287
Length: 36

DNA sequence
>NC_010001, from 4328252 to 4328287 (36 bp); Clostridium phytofermentans ISDg TTCTTTCTTAATTTCTTTCTTGCTTTCTTTCTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4327062-4328393	Sequence	Cphy_3508 - integrase family protein (Protein is coded in complementary strand; from 4328393 to 4327062)