Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3969780
End position: 3969815
Length: 36

DNA sequence
>NC_010001, from 3969780 to 3969815 (36 bp); Clostridium phytofermentans ISDg CTACTGGACCTACTGGGCCTACTGGACCTACTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3969594-3970568	Sequence	Cphy_3262 - triple helix repeat-containing collagen