Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3552573
End position: 3552608
Length: 36

DNA sequence
>NC_010001, from 3552573 to 3552608 (36 bp); Clostridium phytofermentans ISDg TAGCCTTTTTATTAGCCTTTTTATTGGCCTTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3552029-3553351	Sequence	Cphy_2895 - hypothetical protein (Protein is coded in complementary strand; from 3553351 to 3552029)