Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2285784
End position: 2285819
Length: 36

DNA sequence
>NC_010001, from 2285784 to 2285819 (36 bp); Clostridium phytofermentans ISDg CCCATTCCACTCATTCCACTCATTCCACTCATTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2284398-2287055	Sequence	Cphy_1857 - ABC transporter (Protein is coded in complementary strand; from 2287055 to 2284398)