Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1685512
End position: 1685547
Length: 36

DNA sequence
>NC_010001, from 1685512 to 1685547 (36 bp); Clostridium phytofermentans ISDg TCAAAATCATCGTCAAATTCATCGTCAAAATCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1685464-1685871	Sequence	Cphy_1351 - hypothetical protein (Protein is coded in complementary strand; from 1685871 to 1685464)