Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4661971
End position: 4662003
Length: 33

DNA sequence
>NC_010001, from 4661971 to 4662003 (33 bp); Clostridium phytofermentans ISDg TTTTTCAATTCTTTTATAATTCTTTATCAATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4661876-4662448	Sequence	Cphy_3808 - lipoprotein signal peptidase (Protein is coded in complementary strand; from 4662448 to 4661876)