Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4750450
End position: 4750479
Length: 30

DNA sequence
>NC_010001, from 4750450 to 4750479 (30 bp); Clostridium phytofermentans ISDg ATACGAAAAAATACCAATAAATACAATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4748822-4750540	Sequence	Cphy_3867 - methyl-accepting chemotaxis sensory transducer (Protein is coded in complementary strand; from 4750540 to 4748822)