Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3534460
End position: 3534489
Length: 30

DNA sequence
>NC_010001, from 3534460 to 3534489 (30 bp); Clostridium phytofermentans ISDg ATGATCATGGTCGTGATCATGGTCATGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3534176-3535258	Sequence	Cphy_2883 - cobalamin synthesis protein P47K (Protein is coded in complementary strand; from 3535258 to 3534176)