Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3379100
End position: 3379129
Length: 30

DNA sequence
>NC_010001, from 3379100 to 3379129 (30 bp); Clostridium phytofermentans ISDg CACGATCACGGTTACGATCACGATCACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3377233-3380628	Sequence	Cphy_2774 - translation initiation factor IF-2 (Protein is coded in complementary strand; from 3380628 to 3377233)