Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3112745
End position: 3112774
Length: 30

DNA sequence
>NC_010001, from 3112745 to 3112774 (30 bp); Clostridium phytofermentans ISDg TTTTGTATACTTTTATATTCTTCTGTATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3112655-3113005	Sequence	Cphy_2542 - peptidoglycan-binding LysM (Protein is coded in complementary strand; from 3113005 to 3112655)