Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1468345
End position: 1468374
Length: 30

DNA sequence
>NC_010001, from 1468345 to 1468374 (30 bp); Clostridium phytofermentans ISDg ACCAACACCAACGCCAACACCAACGCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1463388-1470152	Sequence	Cphy_1157 - nucleic acid binding OB-fold tRNA/helicase-type