Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3623547
End position: 3623573
Length: 27

DNA sequence
>NC_010001, from 3623547 to 3623573 (27 bp); Clostridium phytofermentans ISDg GCAATGATTGCAATAATTGCAATGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3622743-3624881	Sequence	Cphy_2955 - hypothetical protein (Protein is coded in complementary strand; from 3624881 to 3622743)