Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3389291
End position: 3389317
Length: 27

DNA sequence
>NC_010001, from 3389291 to 3389317 (27 bp); Clostridium phytofermentans ISDg CACTTTGTACACTTTGTGAACTTTGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3387993-3389303	Sequence	Cphy_2782 - phosphoribosyl-ATP diphosphatase (Protein is coded in complementary strand; from 3389303 to 3387993)