Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2354346
End position: 2354372
Length: 27

DNA sequence
>NC_010001, from 2354346 to 2354372 (27 bp); Clostridium phytofermentans ISDg ATTTGATTAATTTGATCAATTTGGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2353743-2355821	Sequence	Cphy_1909 - hypothetical protein (Protein is coded in complementary strand; from 2355821 to 2353743)