Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2329096
End position: 2329122
Length: 27

DNA sequence
>NC_010001, from 2329096 to 2329122 (27 bp); Clostridium phytofermentans ISDg GTAACTCAAGTAACTCAAGTAACTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2327638-2329545	Sequence	Cphy_1886 - peptidoglycan binding domain-containing protein