Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2285786
End position: 2285812
Length: 27

DNA sequence
>NC_010001, from 2285786 to 2285812 (27 bp); Clostridium phytofermentans ISDg CATTCCACTCATTCCACTCATTCCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2284398-2287055	Sequence	Cphy_1857 - ABC transporter (Protein is coded in complementary strand; from 2287055 to 2284398)