Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2079140
End position: 2079166
Length: 27

DNA sequence
>NC_010001, from 2079140 to 2079166 (27 bp); Clostridium phytofermentans ISDg GCACCAGTAGCACCAGTAGCACCAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2078054-2081500	Sequence	Cphy_1694 - triple helix repeat-containing collagen (Protein is coded in complementary strand; from 2081500 to 2078054)