Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1469116
End position: 1469142
Length: 27

DNA sequence
>NC_010001, from 1469116 to 1469142 (27 bp); Clostridium phytofermentans ISDg AACACCAACAACACCTACAACGCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1463388-1470152	Sequence	Cphy_1157 - nucleic acid binding OB-fold tRNA/helicase-type