Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1139246
End position: 1139272
Length: 27

DNA sequence
>NC_010001, from 1139246 to 1139272 (27 bp); Clostridium phytofermentans ISDg TCATCGTATTCATCATATTCATCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1138603-1139820	Sequence	Cphy_0888 - hypothetical protein (Protein is coded in complementary strand; from 1139820 to 1138603)