Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4637802
End position: 4637826
Length: 25

DNA sequence
>NC_010001, from 4637802 to 4637826 (25 bp); Clostridium phytofermentans ISDg AAAAAAGAAAGAAAAAAACAAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4637694-4638797	Sequence	Cphy_3783 - cell envelope-related transcriptional attenuator