Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4511219
End position: 4511243
Length: 25

DNA sequence
>NC_010001, from 4511219 to 4511243 (25 bp); Clostridium phytofermentans ISDg TTTTTTTCTTTTTCTTTTCTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4510691-4511566	Sequence	Cphy_3671 - hypothetical protein (Protein is coded in complementary strand; from 4511566 to 4510691)