Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4780538
End position: 4780561
Length: 24

DNA sequence
>NC_010001, from 4780538 to 4780561 (24 bp); Clostridium phytofermentans ISDg GTGCTTTCGTGCTTTAGTACTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4778508-4782932	Sequence	Cphy_3888 - chromosome segregation ATPase-like protein (Protein is coded in complementary strand; from 4782932 to 4778508)