Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4267737
End position: 4267760
Length: 24

DNA sequence
>NC_010001, from 4267737 to 4267760 (24 bp); Clostridium phytofermentans ISDg GTGTTGGAGTTGGAGTTGCTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4265471-4269316	Sequence	Cphy_3466 - SH3 type 3 domain-containing protein (Protein is coded in complementary strand; from 4269316 to 4265471)