Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3275985
End position: 3276008
Length: 24

DNA sequence
>NC_010001, from 3275985 to 3276008 (24 bp); Clostridium phytofermentans ISDg CTGCTTCTTCTTCTGCTGCTGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3275915-3276238	Sequence	Cphy_2686 - hypothetical protein (Protein is coded in complementary strand; from 3276238 to 3275915)