Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3033451
End position: 3033474
Length: 24

DNA sequence
>NC_010001, from 3033451 to 3033474 (24 bp); Clostridium phytofermentans ISDg GTATTTGTATTTGTATTTGTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3033316-3034548	Sequence	Cphy_2471 - cell division protein FtsZ (Protein is coded in complementary strand; from 3034548 to 3033316)