Sequence retrieval

Genome: Campylobacter concisus 13826
Start position: 593846
End position: 593875
Length: 30

DNA sequence
>NC_009802, from 593846 to 593875 (30 bp); Campylobacter concisus 13826 TCTAAAATTTTCATAAATTTCCTTAAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 593312-593860	Sequence	CCC13826_1608 apt adenine phosphoribosyltransferase (Protein is coded in complementary strand; from 593860 to 593312)