Sequence retrieval

Genome: Campylobacter concisus 13826
Start position: 1031078
End position: 1031107
Length: 30

DNA sequence
>NC_009802, from 1031078 to 1031107 (30 bp); Campylobacter concisus 13826 CAAATTTATTAAAATTTATGCAAATTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1030921-1031349	Sequence	CCC13826_1291 hspR heat shock protein (Protein is coded in complementary strand; from 1031349 to 1030921)