Sequence retrieval

Genome: Campylobacter concisus 13826
Start position: 1447693
End position: 1447717
Length: 25

DNA sequence
>NC_009802, from 1447693 to 1447717 (25 bp); Campylobacter concisus 13826 AAATAAAATCAAAAAGAATAATATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1447136-1447753	Sequence	CCC13826_0440 psd phosphatidylserine decarboxylase (Protein is coded in complementary strand; from 1447753 to 1447136)