Sequence retrieval

Genome: Campylobacter concisus 13826
Start position: 506899
End position: 506922
Length: 24

DNA sequence
>NC_009802, from 506899 to 506922 (24 bp); Campylobacter concisus 13826 TTTTTGTGTTTGTTCTTGATTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 505790-506995	Sequence	CCC13826_1523 - hypothetical protein (Protein is coded in complementary strand; from 506995 to 505790)