Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 4583545
End position: 4583568
Length: 24

DNA sequence
>NC_009792, from 4583545 to 4583568 (24 bp); Citrobacter koseri ATCC BAA-895 CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4583105-4584007	Sequence	CKO_04992 - dipeptide transporter (Protein is coded in complementary strand; from 4584007 to 4583105)