Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 4234967
End position: 4234993
Length: 27

DNA sequence
>NC_009792, from 4234967 to 4234993 (27 bp); Citrobacter koseri ATCC BAA-895 TCGCCGCCATCGCCGCCATCACCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4233926-4235098	Sequence	CKO_04587 obgE GTPase ObgE (Protein is coded in complementary strand; from 4235098 to 4233926)