Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 3717388
End position: 3717411
Length: 24

DNA sequence
>NC_009792, from 3717388 to 3717411 (24 bp); Citrobacter koseri ATCC BAA-895 TCGCCGTCGCCGTGGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3715785-3717695	Sequence	CKO_03993 - hypothetical protein (Protein is coded in complementary strand; from 3717695 to 3715785)