Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 3444849
End position: 3444878
Length: 30

DNA sequence
>NC_009792, from 3444849 to 3444878 (30 bp); Citrobacter koseri ATCC BAA-895 TCGCTGGCACTGGCTGGCAATCACTGGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3444666-3444869	Sequence	CKO_03709 - hypothetical protein (Protein is coded in complementary strand; from 3444869 to 3444666)
ORF. 3444808-3445347	Sequence	CKO_03708 - hypothetical protein