Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 2605289
End position: 2605315
Length: 27

DNA sequence
>NC_009792, from 2605289 to 2605315 (27 bp); Citrobacter koseri ATCC BAA-895 CGCGATCACCGCAATCACCGCGATCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2605221-2606048	Sequence	CKO_02810 - taurine transporter subunit (Protein is coded in complementary strand; from 2606048 to 2605221)