Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 2509454
End position: 2509477
Length: 24

DNA sequence
>NC_009792, from 2509454 to 2509477 (24 bp); Citrobacter koseri ATCC BAA-895 ACCAGCACCCGCGCCAGCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2509151-2510929	Sequence	CKO_02710 - putative multidrug transporter membrane\ATP-binding components (Protein is coded in complementary strand; from 2510929 to 2509151)