Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 2156733
End position: 2156756
Length: 24

DNA sequence
>NC_009792, from 2156733 to 2156756 (24 bp); Citrobacter koseri ATCC BAA-895 GCCCTGTCCCTGACCCTGACCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2156602-2157966	Sequence	CKO_02330 - ATP-dependent RNA helicase RhlE (Protein is coded in complementary strand; from 2157966 to 2156602)