Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 1474495
End position: 1474518
Length: 24

DNA sequence
>NC_009792, from 1474495 to 1474518 (24 bp); Citrobacter koseri ATCC BAA-895 GCCAGCGCCATCGTCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1474045-1474941	Sequence	CKO_01522 - ATP-dependent peptide transporter membrane subunit (Protein is coded in complementary strand; from 1474941 to 1474045)