Sequence retrieval

Genome: Citrobacter koseri ATCC BAA-895
Start position: 1043342
End position: 1043365
Length: 24

DNA sequence
>NC_009792, from 1043342 to 1043365 (24 bp); Citrobacter koseri ATCC BAA-895 CAGCATCAGCGTCAGCATCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1043100-1044368	Sequence	CKO_01064 - hypothetical protein (Protein is coded in complementary strand; from 1044368 to 1043100)