Sequence retrieval

Genome: Ignicoccus hospitalis KIN4/I
Start position: 887543
End position: 887569
Length: 27

DNA sequence
>NC_009776, from 887543 to 887569 (27 bp); Ignicoccus hospitalis KIN4/I TCTCGAGCCTCTCGAGCTTCTCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 887455-888132	Sequence	Igni_0996 - hypothetical protein (Protein is coded in complementary strand; from 888132 to 887455)