Sequence retrieval

Genome: Ignicoccus hospitalis KIN4/I
Start position: 822493
End position: 822516
Length: 24

DNA sequence
>NC_009776, from 822493 to 822516 (24 bp); Ignicoccus hospitalis KIN4/I CCTCGTCCACGTCCTCGGCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 822027-823895	Sequence	Igni_0928 argS arginyl-tRNA synthetase (Protein is coded in complementary strand; from 823895 to 822027)