Sequence retrieval

Genome: Ignicoccus hospitalis KIN4/I
Start position: 712759
End position: 712782
Length: 24

DNA sequence
>NC_009776, from 712759 to 712782 (24 bp); Ignicoccus hospitalis KIN4/I TCCCCACCCCCATGCCCAACCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 711954-713036	Sequence	Igni_0804 - isopentenyl pyrophosphate isomerase (Protein is coded in complementary strand; from 713036 to 711954)