Sequence retrieval

Genome: Ignicoccus hospitalis KIN4/I
Start position: 536975
End position: 536998
Length: 24

DNA sequence
>NC_009776, from 536975 to 536998 (24 bp); Ignicoccus hospitalis KIN4/I ACGCCCACGACCACGTCCACGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 536474-537748	Sequence	Igni_0600 - amidophosphoribosyltransferase (Protein is coded in complementary strand; from 537748 to 536474)