Sequence retrieval

Genome: Ignicoccus hospitalis KIN4/I
Start position: 1018275
End position: 1018301
Length: 27

DNA sequence
>NC_009776, from 1018275 to 1018301 (27 bp); Ignicoccus hospitalis KIN4/I TTGTCTTCCTTGTCTTTCTTATCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1018155-1019198	Sequence	Igni_1140 - CRISPR-associated autoregulator DevR family protein (Protein is coded in complementary strand; from 1019198 to 1018155)