Sequence retrieval

Genome: Ignicoccus hospitalis KIN4/I
Start position: 1184030
End position: 1184053
Length: 24

DNA sequence
>NC_009776, from 1184030 to 1184053 (24 bp); Ignicoccus hospitalis KIN4/I CCACCTCCACCCCCTCCTCCCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1183971-1185188	Sequence	Igni_1331 - Fmu (Sun) domain-containing protein (Protein is coded in complementary strand; from 1185188 to 1183971)