Sequence retrieval

Genome: Bacillus amyloliquefaciens FZB42
Start position: 1820667
End position: 1820714
Length: 48

DNA sequence
>NC_009725, from 1820667 to 1820714 (48 bp); Bacillus amyloliquefaciens FZB42 CCATATCCATACCCATACCCATACCCATATCCATACCCATATCCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1820534-1820719	Sequence	RBAM_017580 - hypothetical protein (Protein is coded in complementary strand; from 1820719 to 1820534)